General Information
The Gene Engineering Division has constructed a BAC library of the B6N substrain and the RIKEN BioResource Research Center (BRC) accomplished BAC end sequencing of B6N and register the sequence data with DDBJ in a collaboration with the National Institute of Genetics under the Genome Information Upgrading Program of MEXT NBRP. The B6N Mouse BAC library consisted of 128,000 clones representing 90.2% of actual coverage of haploid genome.
The germ cell competent C57BL/6N ES cell lines are available from the Cell Engineering Division of BRC.
Individual clone ID can be get on the Mouse BAC browser.
Instruction: Searching BAC clone by the BAC browser
Ordering information
Order Form
- Specify ID of clone(s) ex. B6Ng01-122P06 in the Name of clone column.
Leave Catalog no. column empty.
Order Form: Please complete the form with your shipping information including your account number of an international courier (FedEx. World Courier, TNT Express, DHL Global Forwarding and others). See detail in Information of Request for Distribution Note: The resident of the European Economic Area (EEA) and China, please read Special distribution Information to Residents of the Foreign Countries |
Order Form for Credit Card Payment. (Visa or Master Card only) [Word] |
Order Form for Bank Transfer Payment. [Word] |
Material Transfer Agreement
- Indicate “NBRP B6N mouse BAC clone” as the BIOLOGICAL RESOURCE.
- Please put in the terms and condisions (Section 4) that
“In publishingthe research results to be obtained by use of the B6N mouse BAC clone, an acknowledgment to the RIKEN BioResource Research Center is requested.”
Material Transfer Agreement (Category I MTA) [Word] For the use of our bioresource in research for not-for-profit academic purpose by a non-profit organization.
| Material Transfer Agreement (Category II MTA) [Word] For the use of our bioresource in research for the following cases:
|
Send forms:
The DNA Bank, RIKEN BioResource Research Center (BRC), 3-1-1 Koyadai, Tsukuba, Ibaraki 305-0074, Japan E-mail: dna_sec.brc@riken.jp FAX: (+81)-29-836-9120 |
Please visit further information of distribution and fees.
Distribution fee per clone (as of April 1st, 2023): JPY 9,460 (For use in research for not-for-profit academic purpose). JPY 18,920 (For use in research for-profit-research purpose).
|
Distribution information
- B6N mouse BAC clone(s) is shipped as stab agar culture with 12.5 ug/mL chloramphenicol in an individual tube.
- When you receive the plastic vial of stab culture, please streak the bacteria on an LB agar plate containing 12.5 ug/mL chloramphenicol. We hope you can find colonies.
- When you streak bacteria, please take bacteria from the middle part of stab agar medium but not those from the surface of the stab which are not really healthy.
- The vial should be placed in a refrigerator (4 C degree) but not in a freezer. Stab culture is not meant to be for frozen storage of bacteria.
- Please refer BAC Related Information for further information.
Related Information
Data Sheet
C57BL/6N (B6N) mouse BAC clone | |
Strain information | |
Species | Mus musculus domesticus |
Strain | C57BL/6NCrlCrlj, male |
Clone information | |
Vector | pBACe3.6 (Cmr, U80929), EcoRI site |
Insert | EcoRI partial digestion |
Host | DH10B, E. coli |
Sequence primers | 5′ sequence by T7 primer: TGACATTGTAGGACTATATTGC 3′ sequence by TJ primer: ATCTGCCGTTTCGATCCTCC |
Nucleotide Sequences | DNA Databank of Japan (DDBJ), DH839446 to DH961576, and GA000001 to GA131507 |
Total number of clones | 128,007 |
Actual Genome Coverage | ca. 90.2% |
Reference
- B6N BAC Information site
- Articles Published by Using This Materials
- References and tips
- NIG_MoG2, the NIG Mouse Genome database
- Please visit Informaion site for articles published by using this materials, references and tips.
(GRP0031e 2010.05.06 T.M.)
2023.09.06