Strain Information | |
---|---|
DGRC Number | 140948 |
Genotype with FlyBase Link | y[*] w[*]; PBac{SAstopDsRed}LL06330 P{w[+mW.hs]=FRT(w[hs])}2A P{ry[+t7.2]=neoFRT}82B P{y[+t7.7] ry[+t7.2]=Car20y}96E / TM6B, Tb[1] |
Genotype | y* w*; PBac{SAstopDsRed}LL06330 P{w+mW.hs=FRT(whs)}2A P{ry+t7.2=neoFRT}82B P{y+t7.7 ry+t7.2=Car20y}96E / TM6B, Tb1 |
Break points/Insertion Site | 64B4 |
Related Genes | Syx17 (CG7452) |
Received Date | 25 October 2007 |
Original Number | LL06330 |
Chromosome | 3 |
Original Source | Liqun Luo, Stanford University |
Original Comments | Location: 3L:4403852(+) Cytological Band: 64B4 Gene Symbol-1: Syx17 CG Number-1: CG7452 FlyBase ID-1: FBgn0035540 Insertion Type-1: CDS Gene Symbol-2: CG Number-2: FlyBase ID-2: FBgn0035540 Insertion Type-2: Location coordinates are based on the Drosophila Genome release 5.0. IMPORTANT NOTES: Oren Schuldiner (Weizmann Institute of Science) |
General Information | MARCM |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Lethality | lethal |
Reference | Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L. piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning. Dev Cell (2008) 14(2) 227-38 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Kato S, Arasaki K, Tokutomi N, Imai Y, Inoshita T, Hattori N, Sasaki T, Sato M, Wakana Y, Inoue H, Tagaya M. Syntaxin 17, an ancient SNARE paralog, plays different and conserved roles in different organisms. J Cell Sci (2021) 134(22) [PubMed ID = 34704591] [RRC reference] Boda A, L?rincz P, Takats S, Csizmadia T, Toth S, Kovacs AL, Juhasz G. Drosophila Arl8 is a general positive regulator of lysosomal fusion events. Biochim Biophys Acta Mol Cell Res (2019) 1866(4) 533-544 [PubMed ID = 30590083] [RRC reference] Takats S, Pircs K, Nagy P, Varga A, Karpati M, Heged?s K, Kramer H, Kovacs AL, Sass M, Juhasz G. Interaction of the HOPS complex with Syntaxin 17 mediates autophagosome clearance in Drosophila. Mol Biol Cell (2014) 25(8) 1338-54 [PubMed ID = 24554766] [RRC reference] Takats S, Nagy P, Varga A, Pircs K, Karpati M, Varga K, Kovacs AL, Heged?s K, Juhasz G. Autophagosomal Syntaxin17-dependent lysosomal degradation maintains neuronal function in Drosophila. J Cell Biol (2013) 201(4) 531-9 [PubMed ID = 23671310] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Strand | Plus |
Insertion Point | 4403852 |
Chromosome Band | 3L |
Flanking Sequence | tttacgcagactatctttctagggTTAAACAGGCGGAGGTCTCCATCCAAAGGTTTCAGG ATGTGGCGGTAGGTTATTTACTATATCTTCTGAAGAGCGGAACTAATTCCTTAACACTCA TAGGTGCCCCACCATCTGAGCCTACTGAAAAACCATCGCAGCAATATAGAAAAAAGCCTG GCGCTCGGCGACTGGCAAAAAATCAAAAAGGAGGAACTCAATGCTATGAGGGTCATTAAG CAGATCAAGAATCTACTTCTGGAAATGGATGCACTGCGAGAAAAAGTACGGGAGGAGGAT CTGGAACGTTTCGAAttaaccattgtgggaacactagaac |
Sequence Comment | Location coordinates are based on the Drosophila Genome release 5.0. |