Allele Name | tm252 |
Allele Type | 通常株 |
Sequence Name | C39E6.4 |
Gene Name | mls-2 |
Worm Base | Allele Name |
tm252
|
Gene Name |
mls-2
|
Sequence |
C39E6.4
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. J. Liu: Development 132, 4119-4130 (2005). Dr. P. Sengupta: devective development of chemosensory neurons. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 20622/20623-T-21102/21103 (480 bp deletion + 1 bp insertion) |
Chromosome | X |
Putative gene structure | complement(join(20095..20257, 20304..20530, 20577..20665, 20719..20841, 22155..22390, 22447..22634)) |
Map position | -7 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtFwd:GTCGGCCCTATCAAAGATGA,IntFwd:GTGAAGTACAATGACTACGAC,IntRev:CTCCGAATCTCAGAACACCC,ExtRev:AAACATGAGCAACCCAGGTC |
Distributed lab | |
Depositor | Dr. S. Mitani |
References |
Please submit your publication
Godini R, Pocock R. Characterization of the Doublesex/MAB-3 transcription factor DMD-9 in Caenorhabditis elegans. G3 (Bethesda) 2023 13(2)
[ PubMed ID = 36454093 ]
[ RRC reference ]
|
Hsieh YW, Xiong R, Chuang CF. Synergistic roles of homeodomain proteins UNC-62 homothorax and MLS-2 HMX/NKX in the specification of olfactory neurons in Caenorhabditis elegans. Genetics 2021 219(2)
[ PubMed ID = 34849889 ]
[ RRC reference ]
|
Kim K, Kim R, Sengupta P. The HMX/NKX homeodomain protein MLS-2 specifies the identity of the AWC sensory neuron type via regulation of the ceh-36 Otx gene in C. elegans. Development 2010 137(6) 963-74
[ PubMed ID = 20150279 ]
[ RRC reference ]
|
Jiang Y, Horner V, Liu J. The HMX homeodomain protein MLS-2 regulates cleavage orientation, cell proliferation and cell fate specification in the C. elegans postembryonic mesoderm. Development 2005 132(18) 4119-30
[ PubMed ID = 16107479 ]
[ RRC reference ]
|
|