Allele Name | tm258 |
Allele Type | バランス済 |
Sequence Name | K12H4.1 |
Gene Name | pros-1 |
Worm Base | Allele Name |
tm258
|
Gene Name |
pros-1
|
Sequence |
K12H4.1
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| lethal or sterile. Dr. M. Barr: male mating behavior normal, pkd-2::gfp expression normal. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 26659/26660-27563/27564 (904 bp deletion) |
Chromosome | III |
Putative gene structure | join(25352..25410, 25460..25610, 26128..26274, 26341..26536, 26913..27097, 27145..27367, 27529..28000, 28417..28561, 28608..28715, 28963..29037) |
Map position | -0.44 |
Balancer | hT2 |
Map position of balancer | |
Sequence of primers | ExtFwd:GAAGTCAACGGAAGGGATGA,IntRev:GCACATTTTGAAATGGGGACT,ExtRev:AAATCGGAGGCACAGAAAGT,IntFwd:TGAGACGGAAACGATGACAG |
Distributed lab | |
Depositor | Dr. S. Mitani |
References |
Please submit your publication
Kage-Nakadai E, Ohta A, Ujisawa T, Sun S, Nishikawa Y, Kuhara A, Mitani S. Caenorhabditis elegans homologue of Prox1/Prospero is expressed in the glia and is required for sensory behavior and cold tolerance. Genes Cells 2016 21(9) 936-48
[ PubMed ID = 27402188 ]
[ RRC reference ]
|
Wallace SW, Singhvi A, Liang Y, Lu Y, Shaham S. PROS-1/Prospero Is a Major Regulator of the Glia-Specific Secretome Controlling Sensory-Neuron Shape and Function in C. elegans. Cell Rep 2016 15(3) 550-562
[ PubMed ID = 27068465 ]
[ RRC reference ]
|
|