Allele Name | tm268 |
Allele Type | 通常株 |
Sequence Name | C40H5.5 |
Gene Name | ttx-3 |
Worm Base | Allele Name |
tm268
|
Gene Name |
ttx-3
|
Sequence |
C40H5.5
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. Y. Ohshima (J. Exp. Biol. 206, 2581- 2593, 2003) |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 33367/33368-35306/35307 (1939 bp deletion) |
Chromosome | X |
Putative gene structure | complement(join(29346..29492, 29543..29721, 31095..31256, 31356..31407, 31465..31570, 31878..31948, 32002..32102, 32346..32596, 33843..33961) |
Map position | 6.28 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtRev:AGGCGACGAAAAACAAGAGA,ExtFwd:ATGAAGTTGACCCGTTTTGC,IntFwd:CGGGTCAGTGGGTTTCTTAC,IntRev:AAAATAGAAAACCCCCACGG |
Distributed lab | |
Depositor | Dr. S. Mitani |
References |
Please submit your publication
Wang W, Bouhours M, Gracheva EO, Liao EH, Xu K, Sengar AS, Xin X, Roder J, Boone C, Richmond JE, Zhen M, Egan SE. ITSN-1 controls vesicle recycling at the neuromuscular junction and functions in parallel with DAB-1. Traffic 2008 9(5) 742-54
[ PubMed ID = 18298590 ]
[ RRC reference ]
|
Yamada Y, Ohshima Y. Distribution and movement of Caenorhabditis elegans on a thermal gradient. J Exp Biol 2003 206(Pt 15) 2581-93
[ PubMed ID = 12819265 ]
[ RRC reference ]
|
|