Allele Name | tm239 |
Allele Type | 通常株 |
Sequence Name | C33D12.1 |
Gene Name | ceh-31 |
Worm Base | Allele Name |
tm239
|
Gene Name |
ceh-31
|
Sequence |
C33D12.1
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. J.K. Liu: no defects in the M lineage. Dr. R. Waterston: Dead eggs <10%. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 27769/27770-[F52E4]443/444 (713 bp deletion) |
Chromosome | X |
Putative gene structure | complement(join(26911..27480, 27875..28145, 364..618)) |
Map position | -11.91 |
Balancer | |
Map position of balancer | |
Sequence of primers | IntRev:AAAGCTCGGAAAACGTTTACA,ExtFwd:GGATTTTGAGAATGAGGGCA,ExtRev:CCAGACTATTGCAAACTCGG,IntFwd:ACAGAATCAGGAGATACTGATG |
Distributed lab | |
Depositor | Dr. S. Mitani |
References |
Please submit your publication
Reilly MB, Cros C, Varol E, Yemini E, Hobert O. Unique homeobox codes delineate all the neuron classes of C. elegans. Nature 2020 584(7822) 595-601
[ PubMed ID = 32814896 ]
[ RRC reference ]
|
Gaertner BE, Parmenter MD, Rockman MV, Kruglyak L, Phillips PC. More than the sum of its parts: a complex epistatic network underlies natural variation in thermal preference behavior in Caenorhabditis elegans. Genetics 2012 192(4) 1533-42
[ PubMed ID = 23086219 ]
[ RRC reference ]
|
|