分離済み変異体

tm234

Allele Nametm234
Allele Type通常株
Sequence NameC54C6.2
Gene Nameben-1
Worm BaseAllele Name tm234
Gene Name ben-1
Sequence C54C6.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. Z. Zhou: no persistent cell corpses.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 16845/16846-18981/18982 (2136 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(15233..15408, 16194..16691, 16749..16911, 16964..17319, 18335..18500))
Map position-6.57
Balancer
Map position of balancer
Sequence of primersIntFwd:CTCCGGACATTGTAACGGAA,ExtRev:TCTCCATTTCCTCTTCCTCC,ExtFwd:ACGTGGGAATGGAACCATGT,IntRev:CCCTCCATTTGAAAGAGTCC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Zamanian M, Cook DE, Zdraljevic S, Brady SC, Lee D, Lee J, Andersen EC.
Discovery of genomic intervals that underlie nematode responses to benzimidazoles.
PLoS Negl Trop Dis 2018 12(3) e0006368 
[ PubMed ID = 29601575 ] [ RRC reference ]

Kage-Nakadai E, Kobuna H, Funatsu O, Otori M, Gengyo-Ando K, Yoshina S, Hori S, Mitani S.
Single/low-copy integration of transgenes in Caenorhabditis elegans using an ultraviolet trimethylpsoralen method.
BMC Biotechnol 2012 12 1 
[ PubMed ID = 22217006 ] [ RRC reference ]

Kage-Nakadai E, Imae R, Yoshina S, Mitani S.
Methods for single/low-copy integration by ultraviolet and trimethylpsoralen treatment in Caenorhabditis elegans.
Methods 2014 68(3) 397-402 
[ PubMed ID = 24613935 ] [ RRC reference ]

Kage-Nakadai E, Imae R, Suehiro Y, Yoshina S, Hori S, Mitani S.
A conditional knockout toolkit for Caenorhabditis elegans based on the Cre/loxP recombination.
PLoS One 2014 9(12) e114680 
[ PubMed ID = 25474529 ] [ RRC reference ]

Gengyo-Ando K, Mitani S.
Characterization of mutations induced by ethyl methanesulfonate, UV, and trimethylpsoralen in the nematode Caenorhabditis elegans.
Biochem Biophys Res Commun 2000 269(1) 64-9 
[ PubMed ID = 10694478 ] [ RRC reference ]