Strain Detail
If you wish to request for strains, please contact Yasunori Sasakura () to check if stock is available.
* To order adults, fill in the quantity and click "To order" to add it to your cart.
If you want to change the quantity, click "To cancel", fill in the new quantity and add it to your cart.
Name | Tg[MiCiAKRK]1 | |
Type | Marker | |
Vector | pMiCiAKRK | |
transgene (derived organism) |
• Minos (Drosophila hydei)
• pBluescript (plasmid vector) • Kaede (Trachyphyllia geoffroyi) • SV40 polyadenylation sequence (Papovavirus SV40) • Gateway recombination sequence (lambda phage) |
|
Created Method | DNA electroporation into Ju[SBFr3dTPORCiNutMiTP]1 egg | |
Expression at the larval stage | mesenchyme | |
Expression at the juvenile stage | blood cells, tunic cells, stomach, intestine | |
Expression at the adult stage | ||
Picture at the larval stage | ||
Picture at the juvenile stage | ||
Picture at the adult stage | ||
Phenotypes | ||
Sequence of insertion site | TATTGTCTGTTTGATCAGCTGCGTTCAATCAGTCGCCTGAAATTCGACCA, TACATTTAAGCCTTGCCTGTAAACGCTAAATTTAGTTAAGCCCACGTTTA |
|
Gene present at the insertion site | KH.C9.476 | |
Reference |
Hozumi A et al (2010) Dev. Dyn. 239(4),1076-88
Sasakura Y et al (2018) Wiley Interdiscip Rev Dev Biol 7(2), Nozomu M Totsuka et al (2023) Dev Dyn. Nov;252(11):1363-1374. doi: 10.1002/dvdy.636. Epub 2023 Jun 21. |
|
Available | sperm | |
juvenile | ||
adult |