Bio Reaource World Home National BioResource Project Home
Japanese | English
Organism Category
Keyword
You can use "*" for a wildcard search.
Home >
Tabs(ALL, DNA, BLAST, GO, Taxonomy, DO, Reference) are clickable.
DNA
BLAST
Gene Ontology
Taxonomy
Disease Ontology
Reference
Reference Related Resource Count : 25,573

Associated Resources List

188 items
Strain   188 items Go to list of Strain
DNA   0 items
Organism strain
Zebrafish Wild 1 Go to list
Mutant 7 Go to list
Transgenics 178 Go to list
Mutant, Transgenic 2 Go to list
Organism DNA
Associated Resource is not found.
Strain List 188 items 1 - 20 / 188
Zebrafish: RIKEN WT (RW)  Available RIKEN CBS
Category: Wild
Information : Wild Type
Taxonomy : Siluriformes
Reference : Wada H, Iwasaki M, Sato T, Masai I, Nishiwaki Y, Tanaka H, Sato A, Nojima Y, Okamoto H. (2005) Dual roles of zygotic and maternal Scribble1 in neural migration and convergent extension movements in zebrafish embryos. Development 132(10) 2273-85
Ikeda T, Inamori K, Kawanishi T, Takeda H. (2022) Reemployment of Kupffer''s vesicle cells into axial and paraxial mesoderm via transdifferentiation. Dev Growth Differ 64(3) 163-177
Suzuki H, Li S, Tokutomi T, Takeuchi C, Takahashi M, Yamada M, Okuno H, Miya F, Takenouchi T, Numabe H, Kosaki K, Ohshima T. (2022) De novo non-synonymous DPYSL2 (CRMP2) variants in two patients with intellectual disabilities and documentation of functional relevance through zebrafish rescue and cellular transfection experiments. Hum Mol Genet 31(24) 4173-4182
Komoike Y, Matsuoka M. (2022) Developmental adverse effects of trace amounts of lead: Evaluation using zebrafish model. Front Pharmacol 13 1014912
Guo Y, Oliveros CF, Ohshima T. (2022) CRMP2 and CRMP4 are required for the formation of commissural tracts in the developing zebrafish forebrain. Dev Neurobiol 82(6) 533-544
Kijima Y, Wantong W, Igarashi Y, Yoshitake K, Asakawa S, Suzuki Y, Watabe S, Kinoshita S. (2022) Age-Associated Different Transcriptome Profiling in Zebrafish and Rats: an Insight into the Diversity of Vertebrate Aging. Mar Biotechnol (NY) 24(5) 895-910
Mizoguchi T, Mikami S, Yatou M, Kondo Y, Omaru S, Kuwabara S, Okura W, Noda S, Tenno T, Hiroaki H, Itoh M. (2023) Small-Molecule-Mediated Suppression of BMP Signaling by Selective Inhibition of BMP1-Dependent Chordin Cleavage. Int J Mol Sci 24(5)
Ikeda A, Yamasaki C, Kubo Y, Doi Y, Komamizu M, Komatsu M, Shiozaki K. (2022) Alteration of the neuronal and glial cell profiles in Neu1-deficient zebrafish. Glycoconj J 39(4) 499-512
Kawabe M, Nishida T, Horita C, Ikeda A, Takahashi R, Inui A, Shiozaki K. (2022) Ninjinyoeito improves social behavior disorder in neuropeptide Y deficient zebrafish. Front Pharmacol 13 905711
Liu J, Kasuya G, Zempo B, Nakajo K. (2022) Two HCN4 Channels Play Functional Roles in the Zebrafish Heart. Front Physiol 13 901571
Tran NT, Vo LK, Komatsu M, Shiozaki K. (2022) Involvement of N-acetylneuraminate cytidylyltransferase in Edwardsiella piscicida pathogenicity. Fish Shellfish Immunol 124 534-542
Sahashi D, Kubo Y, Ishii M, Ikeda A, Yamasaki C, Komatsu M, Shiozaki K. (2022) Neu1 deficiency increases the susceptibility of zebrafish to Edwardsiella piscicida infection via lysosomal dysfunction. Gene 836 146667
Kawakami A, Nojima Y, Toyoda A, Takahoko M, Satoh M, Tanaka H, Wada H, Masai I, Terasaki H, Sakaki Y, Takeda H, Okamoto H. (2005) The zebrafish-secreted matrix protein you/scube2 is implicated in long-range regulation of hedgehog signaling. Curr Biol 15(5) 480-8
Hanaoka R, Katayama S, Dawid IB, Kawahara A. (2006) Characterization of the heme synthesis enzyme coproporphyrinogen oxidase (CPO) in zebrafish erythrogenesis. Genes Cells 11(3) 293-303
Nishiwaki Y, Komori A, Sagara H, Suzuki E, Manabe T, Hosoya T, Nojima Y, Wada H, Tanaka H, Okamoto H, Masai I. (2008) Mutation of cGMP phosphodiesterase 6alpha''-subunit gene causes progressive degeneration of cone photoreceptors in zebrafish. Mech Dev 125(11-12) 932-46
Masai I, Lele Z, Yamaguchi M, Komori A, Nakata A, Nishiwaki Y, Wada H, Tanaka H, Nojima Y, Hammerschmidt M, Wilson SW, Okamoto H. (2003) N-cadherin mediates retinal lamination, maintenance of forebrain compartments and patterning of retinal neurites. Development 130(11) 2479-94
Yamaguchi M, Tonou-Fujimori N, Komori A, Maeda R, Nojima Y, Li H, Okamoto H, Masai I. (2005) Histone deacetylase 1 regulates retinal neurogenesis in zebrafish by suppressing Wnt and Notch signaling pathways. Development 132(13) 3027-43
Aizawa H, Goto M, Sato T, Okamoto H. (2007) Temporally regulated asymmetric neurogenesis causes left-right difference in the zebrafish habenular structures. Dev Cell 12(1) 87-98
Wada H, Tanaka H, Nakayama S, Iwasaki M, Okamoto H. (2006) Frizzled3a and Celsr2 function in the neuroepithelium to regulate migration of facial motor neurons in the developing zebrafish hindbrain. Development 133(23) 4749-59
Yamaguchi M, Fujimori-Tonou N, Yoshimura Y, Kishi T, Okamoto H, Masai I. (2008) Mutation of DNA primase causes extensive apoptosis of retinal neurons through the activation of DNA damage checkpoint and tumor suppressor p53. Development 135(7) 1247-57
Tanaka H, Maeda R, Shoji W, Wada H, Masai I, Shiraki T, Kobayashi M, Nakayama R, Okamoto H. (2007) Novel mutations affecting axon guidance in zebrafish and a role for plexin signalling in the guidance of trigeminal and facial nerve axons. Development 134(18) 3259-69
Zebrafish: landlocked  Available RIKEN CBS
Category: Mutant
Allele : rw16
Information : Mutant shows highly specific defects in the caudal migration of the nVII motor neurons. The maternal and zygotic mutant shows defects in convergent extension (CE) movements during gastrulation. rw16 allele has a point mutation (amino acid substitution) in the first PDZ domain of Scrb1.
Gene : scribble1
Publications : Wada H et al (2005) Development 132(10),2273-85
Taxonomy : Siluriformes
Reference : Sun SD, Purdy AM, Walsh GS. (2016) Planar cell polarity genes Frizzled3a, Vangl2, and Scribble are required for spinal commissural axon guidance. BMC Neurosci 17(1) 83
McArthur KL, Fetcho JR. (2017) Key Features of Structural and Functional Organization of Zebrafish Facial Motor Neurons Are Resilient to Disruption of Neuronal Migration. Curr Biol 27(12) 1746-1756.e5
Zebrafish: landlocked  Available RIKEN CBS
Category: Mutant
Allele : rw468
Information : Mutant shows highly specific defects in the caudal migration of the nVII motor neurons.The maternal and zygotic mutant shows defects in convergent extension (CE) movements during gastrulation.rw468 allele has a point mutation (stop codon) in the LRR domain of Scrb1.
Gene : scribble1
Publications : Wada H et al (2005) Development 132(10),2273-85
Taxonomy : Siluriformes
Reference : Sun SD, Purdy AM, Walsh GS. (2016) Planar cell polarity genes Frizzled3a, Vangl2, and Scribble are required for spinal commissural axon guidance. BMC Neurosci 17(1) 83
McArthur KL, Fetcho JR. (2017) Key Features of Structural and Functional Organization of Zebrafish Facial Motor Neurons Are Resilient to Disruption of Neuronal Migration. Curr Biol 27(12) 1746-1756.e5
Zebrafish: ko157  Available RIKEN CBS
Category: Mutant
Zebrafish: ko095  Available RIKEN CBS
Category: Mutant
Zebrafish: cacnb1  Available RIKEN CBS
Category: Mutant
Allele : mi90
Information : The cacnb1 mutants are called relaxed mutants.The mutant phenotype results from a non-sense mutation in the zebrafish cacnb1 gene that encodes the voltage-gated calcium channel beta1 subunit. The zebrafish cacnb1 gene is expressed in skeletal muscles, PNS and CNS. The mutants are immotile due to a defect in excitation-contraction coupling of skeletal muscle.
Gene : cacnb1(Cacnb1)
Publications : Zhou W et al (2006) Cell Calcium 39(3),227-36
Taxonomy : Siluriformes
Reference : Linsley JW, Hsu IU, Wang W, Kuwada JY. (2017) Transport of the alpha subunit of the voltage gated L-type calcium channel through the sarcoplasmic reticulum occurs prior to localization to triads and requires the beta subunit but not Stac3 in skeletal muscles. Traffic 18(9) 622-632
Zebrafish: evanescence  Available RIKEN CBS
Category: Mutant
Allele : rk10
Information : Loss or strong reduction of granule cells; reduction of Purkinje cells; eye degeneration.
Publications : Bae YK et al (2009) Dev. Biol. 330(2),406-26
Taxonomy : Siluriformes
Reference : Song KH, Woo SR, Chung JY, Lee HJ, Oh SJ, Hong SO, Shim J, Kim YN, Rho SB, Hong SM, Cho H, Hibi M, Bae DJ, Kim SY, Kim MG, Kim TW, Bae YK. (2017) REP1 inhibits FOXO3-mediated apoptosis to promote cancer cell survival. Cell Death Dis 8(1) e2536
Zebrafish: cfdp1  Available RIKEN CBS
Category: Mutant
Allele : ex2+130
Information : A insertion-deletion mutation (+132 bp, -2bp) was introduced in the exon2 of cfdp1 gene by a CRISPR method. The mutation can be detected by PCR with the primers: cfdp1-ex2+130-f, GATAACTTGAGTGAGGATGACAcfdp1-ex2+130-r, CTCATATGGACATCTGCTTTACMutation:WT GAAGGGGAGGATCA------------------------------------------------------------------------------------------------------------------------------------CGACCGGCAGACGCCGMUT GAAGGGGAGGATCAGAAGGAAAAAATACTCATTTTTAACTATGGAAAATATTAGAAAGATTTTAACTAACAGTATATAGAGAAATGAAGGTCAATGGAGTTGGAAATCTGCTACTTCATATTGTACTGCTCCCAAGAGTTGTAAAT--ACCGGCAGACGCCG+132 bp, -2bp
Gene : cfdp1
Taxonomy : Siluriformes
Reference : Itoh T, Inoue S, Sun X, Kusuda R, Hibi M, Shimizu T. (2021) Cfdp1 controls the cell cycle and neural differentiation in the zebrafish cerebellum and retina. Dev Dyn 250(11) 1618-1633
Zebrafish: Tg(CM-isl1:GFP)  Available RIKEN CBS
Category: Transgenics
Allele : rw0
Information : GFP expression in the hindbrain motor neurons. (Previous Name) Tg (CM-ICP:GFP)
Publications : Higashijima S et al (2000) J. Neurosci. 20(1),206-18
Taxonomy : Siluriformes
Reference : Gan-Or Z, Bouslam N, Birouk N, Lissouba A, Chambers DB, Vérièpe J, Androschuk A, Laurent SB, Rochefort D, Spiegelman D, Dionne-Laporte A, Szuto A, Liao M, Figlewicz DA, Bouhouche A, Benomar A, Yahyaoui M, Ouazzani R, Yoon G, Dupré N, Suchowersky O, Bolduc FV, Parker JA, Dion PA, Drapeau P, Rouleau GA, Ouled Amar Bencheikh B. (2016) Mutations in CAPN1 Cause Autosomal-Recessive Hereditary Spastic Paraplegia. Am J Hum Genet 98(6) 1271
Rebman JK, Kirchoff KE, Walsh GS. (2016) Cadherin-2 Is Required Cell Autonomously for Collective Migration of Facial Branchiomotor Neurons. PLoS One 11(10) e0164433
Turner KJ, Hawkins TA, Yáñez J, Anadón R, Wilson SW, Folgueira M. (2016) Afferent Connectivity of the Zebrafish Habenulae. Front Neural Circuits 10 30
Chen L, Watson C, Morsch M, Cole NJ, Chung RS, Saunders DN, Yerbury JJ, Vine KL. (2017) Improving the Delivery of SOD1 Antisense Oligonucleotides to Motor Neurons Using Calcium Phosphate-Lipid Nanoparticles. Front Neurosci 11 476
Schoppik D, Bianco IH, Prober DA, Douglass AD, Robson DN, Li JMB, Greenwood JSF, Soucy E, Engert F, Schier AF. (2017) Gaze-Stabilizing Central Vestibular Neurons Project Asymmetrically to Extraocular Motoneuron Pools. J Neurosci 37(47) 11353-11365
Yang CH, Yeh YJ, Wang JY, Liu YW, Chen YL, Cheng HW, Cheng CM, Chuang YJ, Yuh CH, Chen YR. (2017) NEAP/DUSP26 suppresses receptor tyrosine kinases and regulates neuronal development in zebrafish. Sci Rep 7(1) 5241
Gupta T, Marquart GD, Horstick EJ, Tabor KM, Pajevic S, Burgess HA. (2018) Morphometric analysis and neuroanatomical mapping of the zebrafish brain. Methods 150 49-62
Gauron C, Meda F, Dupont E, Albadri S, Quenech''Du N, Ipendey E, Volovitch M, Del Bene F, Joliot A, Rampon C, Vriz S. (2016) Hydrogen peroxide (H2O2) controls axon pathfinding during zebrafish development. Dev Biol 414(2) 133-41
Giunta M, Edvardson S, Xu Y, Schuelke M, Gomez-Duran A, Boczonadi V, Elpeleg O, Müller JS, Horvath R. (2016) Altered RNA metabolism due to a homozygous RBM7 mutation in a patient with spinal motor neuropathy. Hum Mol Genet 25(14) 2985-2996
Greaney MR, Privorotskiy AE, D''Elia KP, Schoppik D. (2017) Extraocular motoneuron pools develop along a dorsoventral axis in zebrafish, Danio rerio. J Comp Neurol 525(1) 65-78
McCammon JM, Blaker-Lee A, Chen X, Sive H. (2017) The 16p11.2 homologs fam57ba and doc2a generate certain brain and body phenotypes. Hum Mol Genet 26(19) 3699-3712
Moreno RL, Josey M, Ribera AB. (2017) Zebrafish In Situ Spinal Cord Preparation for Electrophysiological Recordings from Spinal Sensory and Motor Neurons. J Vis Exp (122)
Morsch M, Radford RA, Don EK, Lee A, Hortle E, Cole NJ, Chung RS. (2017) Triggering Cell Stress and Death Using Conventional UV Laser Confocal Microscopy. J Vis Exp (120)
Sebe JY, Cho S, Sheets L, Rutherford MA, von Gersdorff H, Raible DW. (2017) Ca
Thomas-Jinu S, Gordon PM, Fielding T, Taylor R, Smith BN, Snowden V, Blanc E, Vance C, Topp S, Wong CH, Bielen H, Williams KL, McCann EP, Nicholson GA, Pan-Vazquez A, Fox AH, Bond CS, Talbot WS, Blair IP, Shaw CE, Houart C. (2017) Non-nuclear Pool of Splicing Factor SFPQ Regulates Axonal Transcripts Required for Normal Motor Development. Neuron 94(2) 322-336.e5
Yin C, Fufa T, Chandrasekar G, Aeluri M, Zaky V, Abdelhady S, Rodríguez AB, Jakobsson J, Varnoosfaderani FS, Mahalingam J, Liu J, Larsson O, Hovatta O, Gaunitz F, Göndör A, Andäng M, Kitambi SS. (2017) Phenotypic Screen Identifies a Small Molecule Modulating ERK2 and Promoting Stem Cell Proliferation. Front Pharmacol 8 726
Bremer J, Skinner J, Granato M. (2017) A small molecule screen identifies in vivo modulators of peripheral nerve regeneration in zebrafish. PLoS One 12(6) e0178854
Acosta JR, Watchon M, Yuan KC, Fifita JA, Svahn AJ, Don EK, Winnick CG, Blair IP, Nicholson GA, Cole NJ, Goldsbury C, Laird AS. (2018) Neuronal cell culture from transgenic zebrafish models of neurodegenerative disease. Biol Open 7(10)
Burns DT, Donkervoort S, Müller JS, Knierim E, Bharucha-Goebel D, Faqeih EA, Bell SK, AlFaifi AY, Monies D, Millan F, Retterer K, Dyack S, MacKay S, Morales-Gonzalez S, Giunta M, Munro B, Hudson G, Scavina M, Baker L, Massini TC, Lek M, Hu Y, Ezzo D, AlKuraya FS, Kang PB, Griffin H, Foley AR, Schuelke M, Horvath R, Bönnemann CG. (2018) Variants in EXOSC9 Disrupt the RNA Exosome and Result in Cerebellar Atrophy with Spinal Motor Neuronopathy. Am J Hum Genet 102(5) 858-873
Fassier C, Fréal A, Gasmi L, Delphin C, Ten Martin D, De Gois S, Tambalo M, Bosc C, Mailly P, Revenu C, Peris L, Bolte S, Schneider-Maunoury S, Houart C, Nothias F, Larcher JC, Andrieux A, Hazan J. (2018) Motor axon navigation relies on Fidgetin-like 1-driven microtubule plus end dynamics. J Cell Biol 217(5) 1719-1738
Goldshmit Y, Tang JKKY, Siegel AL, Nguyen PD, Kaslin J, Currie PD, Jusuf PR. (2018) Different Fgfs have distinct roles in regulating neurogenesis after spinal cord injury in zebrafish. Neural Dev 13(1) 24
Gurung S, Asante E, Hummel D, Williams A, Feldman-Schultz O, Halloran MC, Sittaramane V, Chandrasekhar A. (2018) Distinct roles for the cell adhesion molecule Contactin2 in the development and function of neural circuits in zebrafish. Mech Dev 152 1-12
Selland LG, Koch S, Laraque M, Waskiewicz AJ. (2018) Coordinate regulation of retinoic acid synthesis by pbx genes and fibroblast growth factor signaling by hoxb1b is required for hindbrain patterning and development. Mech Dev 150 28-41
O''Connor E, Töpf A, Müller JS, Cox D, Evangelista T, Colomer J, Abicht A, Senderek J, Hasselmann O, Yaramis A, Laval SH, Lochmüller H. (2016) Identification of mutations in the MYO9A gene in patients with congenital myasthenic syndrome. Brain 139(Pt 8) 2143-53
Marquart GD, Tabor KM, Horstick EJ, Brown M, Geoca AK, Polys NF, Nogare DD, Burgess HA. (2017) High-precision registration between zebrafish brain atlases using symmetric diffeomorphic normalization. Gigascience 6(8) 1-15
Allen JR, Bhattacharyya KD, Asante E, Almadi B, Schafer K, Davis J, Cox J, Voigt M, Viator JA, Chandrasekhar A. (2017) Role of branchiomotor neurons in controlling food intake of zebrafish larvae. J Neurogenet 31(3) 128-137
McArthur KL, Fetcho JR. (2017) Key Features of Structural and Functional Organization of Zebrafish Facial Motor Neurons Are Resilient to Disruption of Neuronal Migration. Curr Biol 27(12) 1746-1756.e5
Sassen WA, Lehne F, Russo G, Wargenau S, Dübel S, Köster RW. (2017) Embryonic zebrafish primary cell culture for transfection and live cellular and subcellular imaging. Dev Biol 430(1) 18-31
Zebrafish: Tg (zCREST2-hsp70:GFP)  Available RIKEN CBS
Category: Transgenics
Zebrafish: Tg (brn3a-hsp70:GFP )  Available RIKEN CBS
Category: Transgenics
Zebrafish: Tg (Huc:Kaede)  Available RIKEN CBS
Category: Transgenics
Zebrafish: Tg(OMP2k :lyn-mRFP)  Available RIKEN CBS
Category: Transgenics
Zebrafish: Tg(TRPC24.5k :gap-Venus)  Available RIKEN CBS
Category: Transgenics
Allele : rw037
Information : gap-Venus expression in microvillous olfactory sensory neurons
Publications : Sato Y et al (2005) J. Neurosci. 25(20),4889-97
Taxonomy : Siluriformes
Reference : Bergboer JGM, Wyatt C, Austin-Tse C, Yaksi E, Drummond IA. (2018) Assaying sensory ciliopathies using calcium biosensor expression in zebrafish ciliated olfactory neurons. Cilia 7 2
Zebrafish: Tg(HuC:cameleon2.1)  Available RIKEN CBS
Category: Transgenics
Allele : cf2
Information : "all neuronal cells express cameleon2.1, a calcium indicator generated based on GFP, under the control of the HuC promoter"Method for Generation: plasmid
Publications : Higashijima S et al (2003) J. Neurophysiol. 90(6),3986-97
Taxonomy : Siluriformes
Reference : Yao Y, Li X, Zhang B, Yin C, Liu Y, Chen W, Zeng S, Du J. (2016) Visual Cue-Discriminative Dopaminergic Control of Visuomotor Transformation and Behavior Selection. Neuron 89(3) 598-612
Xu B, Zhang Y, Du XF, Li J, Zi HX, Bu JW, Yan Y, Han H, Du JL. (2017) Neurons secrete miR-132-containing exosomes to regulate brain vascular integrity. Cell Res 27(7) 882-897
Zebrafish: Tg(chx10:GFP)  Available RIKEN CBS
Category: Transgenics
Allele : nns1
Information : Transgenic zebrafish that express EGFP under the control of the alx promoter/enhancer.Method for Generation: BAC, ISceI
Publications : Kimura Y et al (2006) J. Neurosci. 26(21),5684-97
Taxonomy : Siluriformes
Reference : Seredick S, Hutchinson SA, Van Ryswyk L, Talbot JC, Eisen JS. (2014) Lhx3 and Lhx4 suppress Kolmer-Agduhr interneuron characteristics within zebrafish axial motoneurons. Development 141(20) 3900-9
Van Ryswyk L, Simonson L, Eisen JS. (2014) The role of inab in axon morphology of an identified zebrafish motoneuron. PLoS One 9(2) e88631
Reinoß P, Ciglieri E, Minére M, Bremser S, Klein A, Löhr H, Fuller PM, Büschges A, Kloppenburg P, Fenselau H, Hammerschmidt M. (2020) Hypothalamic Pomc Neurons Innervate the Spinal Cord and Modulate the Excitability of Premotor Circuits. Curr Biol 30(23) 4579-4593.e7
Stil A, Drapeau P. (2016) Neuronal labeling patterns in the spinal cord of adult transgenic Zebrafish. Dev Neurobiol 76(6) 642-60
Engerer P, Petridou E, Williams PR, Suzuki SC, Yoshimatsu T, Portugues R, Misgeld T, Godinho L. (2021) Notch-mediated re-specification of neuronal identity during central nervous system development. Curr Biol 31(21) 4870-4878.e5
Wu MY, Carbo-Tano M, Mirat O, Lejeune FX, Roussel J, Quan FB, Fidelin K, Wyart C. (2021) Spinal sensory neurons project onto the hindbrain to stabilize posture and enhance locomotor speed. Curr Biol 31(15) 3315-3329.e5
Chang W, Pedroni A, Bertuzzi M, Kizil C, Simon A, Ampatzis K. (2021) Locomotion dependent neuron-glia interactions control neurogenesis and regeneration in the adult zebrafish spinal cord. Nat Commun 12(1) 4857
Guan NN, Xu L, Zhang T, Huang CX, Wang Z, Dahlberg E, Wang H, Wang F, Pallucchi I, Hua Y, El Manira A, Song J. (2021) A specialized spinal circuit for command amplification and directionality during escape behavior. Proc Natl Acad Sci U S A 118(42)
Roussel Y, Paradis M, Gaudreau SF, Lindsey BW, Bui TV. (2020) Spatiotemporal Transition in the Role of Synaptic Inhibition to the Tail Beat Rhythm of Developing Larval Zebrafish. eNeuro 7(1)
Evdokia Menelaou, Sandeep Kishore, David L McLean (2022) Mixed synapses reconcile violations of the size principle in zebrafish spinal cord eLife 11
Chun-Xiao Huang, Zhen Wang, Jianwei Cheng, Zhiqiang Zhu, Na N. Guan, Jianren Song (2022) De novo establishment of circuit modules restores locomotion after spinal cord injury in adult zebrafish Cell Reports 41 111535
Saul Bello-Rojas, Martha W Bagnall (2022) Clonally related, Notch-differentiated spinal neurons integrate into distinct circuits eLife 11
Pujala A, Koyama M. (2019) Chronology-based architecture of descending circuits that underlie the development of locomotor repertoire after birth. Elife 8
Kinkhabwala A, Riley M, Koyama M, Monen J, Satou C, Kimura Y, Higashijima S, Fetcho J. (2011) A structural and functional ground plan for neurons in the hindbrain of zebrafish. Proc Natl Acad Sci U S A 108(3) 1164-9
Ampatzis K, Song J, Ausborn J, El Manira A. (2014) Separate microcircuit modules of distinct v2a interneurons and motoneurons control the speed of locomotion. Neuron 83(4) 934-43
Song J, Ampatzis K, Björnfors ER, El Manira A. (2016) Motor neurons control locomotor circuit function retrogradely via gap junctions. Nature 529(7586) 399-402
Valdivia LE, Lamb DB, Horner W, Wierzbicki C, Tafessu A, Williams AM, Gestri G, Krasnow AM, Vleeshouwer-Neumann TS, Givens M, Young RM, Lawrence LM, Stickney HL, Hawkins TA, Schwarz QP, Cavodeassi F, Wilson SW, Cerveny KL. (2016) Antagonism between Gdf6a and retinoic acid pathways controls timing of retinal neurogenesis and growth of the eye in zebrafish. Development 143(7) 1087-98
Song J, Dahlberg E, El Manira A. (2018) V2a interneuron diversity tailors spinal circuit organization to control the vigor of locomotor movements. Nat Commun 9(1) 3370
Rulands S, Iglesias-Gonzalez AB, Boije H. (2018) Deterministic fate assignment of Müller glia cells in the zebrafish retina suggests a clonal backbone during development. Eur J Neurosci 48(12) 3597-3605
Almeida AD, Boije H, Chow RW, He J, Tham J, Suzuki SC, Harris WA. (2014) Spectrum of Fates: a new approach to the study of the developing zebrafish retina. Development 141(9) 1971-80
Weber IP, Ramos AP, Strzyz PJ, Leung LC, Young S, Norden C. (2014) Mitotic position and morphology of committed precursor cells in the zebrafish retina adapt to architectural changes upon tissue maturation. Cell Rep 7(2) 386-397
Sternberg JR, Severi KE, Fidelin K, Gomez J, Ihara H, Alcheikh Y, Hubbard JM, Kawakami K, Suster M, Wyart C. (2016) Optimization of a Neurotoxin to Investigate the Contribution of Excitatory Interneurons to Speed Modulation In Vivo. Curr Biol 26(17) 2319-28
Hilinski WC, Bostrom JR, England SJ, Juárez-Morales JL, de Jager S, Armant O, Legradi J, Strähle U, Link BA, Lewis KE. (2016) Lmx1b is required for the glutamatergic fates of a subset of spinal cord neurons. Neural Dev 11(1) 16
Pedroni A, Ampatzis K. (2019) Large-Scale Analysis of the Diversity and Complexity of the Adult Spinal Cord Neurotransmitter Typology. iScience 19 1189-1201
Menelaou E, McLean DL. (2019) Hierarchical control of locomotion by distinct types of spinal V2a interneurons in zebrafish. Nat Commun 10(1) 4197
Song J, Pallucchi I, Ausborn J, Ampatzis K, Bertuzzi M, Fontanel P, Picton LD, El Manira A. (2020) Multiple Rhythm-Generating Circuits Act in Tandem with Pacemaker Properties to Control the Start and Speed of Locomotion. Neuron 105(6) 1048-1061.e4
Zebrafish: Tg(chx10:loxp-dsRED-loxp-GFP)  Available RIKEN CBS
Category: Transgenics
Zebrafish: Tg(chx10:Kaede)  Available RIKEN CBS
Category: Transgenics
Allele : nns2
Information : Transgenic zebrafish that express Kaede under the control of the alx promoter/enhancer.Method for Generation: BAC, ISceI
Publications : Kimura Y et al (2006) J. Neurosci. 26(21),5684-97
Taxonomy : Siluriformes
Reference : Pujala A, Koyama M. (2019) Chronology-based architecture of descending circuits that underlie the development of locomotor repertoire after birth. Elife 8
Batista MF, Jacobstein J, Lewis KE. (2008) Zebrafish V2 cells develop into excitatory CiD and Notch signalling dependent inhibitory VeLD interneurons. Dev Biol 322(2) 263-75
Zebrafish: Tg(zfRh1-3.7B:EGFP)  Available RIKEN CBS
Category: Transgenics
Allele : kj2
Information : The reporter constructThe 3.7-kb region immediately upstream of the zebrafish RH1 opsin (rod opsin or rhodopsin) was cloned into pEGFP-1(Clontech) plasmid at SalI/BamHI.PhenotypeGFP fluorescence is observable in the retina after ~50 hpf (hours post fertilization) under a fluorescent microscope. It takes about 4~5 dpf (days post fertilization) for the GFP signal to be strong enough to be easily detectable under a stereo fluorescence microscope.Examination of transgene by PCRGenomic DNA is extracted from a fin clip at 1~2 months old. A portion of pEGFP sequence is PCR-amplified by the following primer pair: 5'-tacggcgtgcagtgcttcag-3' and 5'-tgttgtagttgtactccagc-3'.
Publications : Hamaoka T et al (2002) Genesis 34(3),215-20
Taxonomy : Siluriformes
Reference : Noel NCL, Allison WT. (2018) Connectivity of cone photoreceptor telodendria in the zebrafish retina. J Comp Neurol 526(4) 609-625
Ojeda Naharros I, Cristian FB, Zang J, Gesemann M, Ingham PW, Neuhauss SCF, Bachmann-Gagescu R. (2018) The ciliopathy protein TALPID3/KIAA0586 acts upstream of Rab8 activation in zebrafish photoreceptor outer segment formation and maintenance. Sci Rep 8(1) 2211
Zebrafish: Tg(zfSWS1-5.5A:EGFP)  Available RIKEN CBS
Category: Transgenics
Allele : kj9
Information : The reporter constructThe 5.5-kb region immediately upstream of the zebrafish SWS1 (UV-sensitive) opsin was cloned into pEGFP-1(Clontech) plasmid at EcoRI/SalI.PhenotypeGFP fluorescence is observable in the retina after ~55 hpf (hours post fertilization) under a fluorescent microscope. It takes about 4~5 dpf (days post fertilization) for the GFP signal to be strong enough to be easily detectable under a stereo fluorescence microscope.Examination of transgene by PCRGenomic DNA is extracted from a fin clip at 1~2 months old. A portion of pEGFP sequence is PCR-amplified by the following primer pair: 5'-tacggcgtgcagtgcttcag-3' and 5'-tgttgtagttgtactccagc-3'.
Publications : Takechi M et al (2003) FEBS Lett. 553(1-2),90-4
Taxonomy : Siluriformes
Reference : Crespo C, Knust E. (2018) Characterisation of maturation of photoreceptor cell subtypes during zebrafish retinal development. Biol Open 7(11)
D''Orazi FD, Zhao XF, Wong RO, Yoshimatsu T. (2016) Mismatch of Synaptic Patterns between Neurons Produced in Regeneration and during Development of the Vertebrate Retina. Curr Biol 26(17) 2268-79
Fang W, Guo C, Wei X. (2017) <i>Rainbow</i> Enhancers Regulate Restrictive Transcription in Teleost Green, Red, and Blue Cones. J Neurosci 37(11) 2834-2848
Nagashima M, Hadidjojo J, Barthel LK, Lubensky DK, Raymond PA. (2017) Anisotropic Müller glial scaffolding supports a multiplex lattice mosaic of photoreceptors in zebrafish retina. Neural Dev 12(1) 20
Niklaus S, Cadetti L, Vom Berg-Maurer CM, Lehnherr A, Hotz AL, Forster IC, Gesemann M, Neuhauss SCF. (2017) Shaping of Signal Transmission at the Photoreceptor Synapse by EAAT2 Glutamate Transporters. eNeuro 4(3)
Noel NCL, Allison WT. (2018) Connectivity of cone photoreceptor telodendria in the zebrafish retina. J Comp Neurol 526(4) 609-625
Sun C, Mitchell DM, Stenkamp DL. (2018) Isolation of photoreceptors from mature, developing, and regenerated zebrafish retinas, and of microglia/macrophages from regenerating zebrafish retinas. Exp Eye Res 177 130-144
Zimmermann MJY, Nevala NE, Yoshimatsu T, Osorio D, Nilsson DE, Berens P, Baden T. (2018) Zebrafish Differentially Process Color across Visual Space to Match Natural Scenes. Curr Biol 28(13) 2018-2032.e5
Li YN, Tsujimura T, Kawamura S, Dowling JE. (2012) Bipolar cell-photoreceptor connectivity in the zebrafish (Danio rerio) retina. J Comp Neurol 520(16) 3786-802
Novales Flamarique I. (2016) Diminished foraging performance of a mutant zebrafish with reduced population of ultraviolet cones. Proc Biol Sci 283(1826) 20160058
Yoshimatsu T, D''Orazi FD, Gamlin CR, Suzuki SC, Suli A, Kimelman D, Raible DW, Wong RO. (2016) Presynaptic partner selection during retinal circuit reassembly varies with timing of neuronal regeneration in vivo. Nat Commun 7 10590
DNA List 0 items
Associated Resource is not found.