Home |
Tabs(ALL, DNA, BLAST, GO, Taxonomy, DO, Reference) are clickable.
|
|||||||||
Reference Related Resource Count: 33,482 |
Organism
Zebrafish
Category
Mutant
strain or clone
Strain
Associated Resources List |
7 items | Page: 1 / 1 1 | 1 - 7 / 7 | Show All |
Zebrafish: | landlocked more | Available | RIKEN CBS |
Category: Mutant
Allele : | rw16 |
Information : | Mutant shows highly specific defects in the caudal migration of the nVII motor neurons. The maternal and zygotic mutant shows defects in convergent extension (CE) movements during gastrulation. rw16 allele has a point mutation (amino acid substitution) in the first PDZ domain of Scrb1. |
Gene : | scribble1 |
Publications : | Wada H et al (2005) Development 132(10),2273-85 |
Taxonomy : | Siluriformes |
Reference : | Sun SD, Purdy AM, Walsh GS. (2016) Planar cell polarity genes Frizzled3a, Vangl2, and Scribble are required for spinal commissural axon guidance. BMC Neurosci 17(1) 83 McArthur KL, Fetcho JR. (2017) Key Features of Structural and Functional Organization of Zebrafish Facial Motor Neurons Are Resilient to Disruption of Neuronal Migration. Curr Biol 27(12) 1746-1756.e5 |
Zebrafish: | landlocked more | Available | RIKEN CBS |
Category: Mutant
Allele : | rw468 |
Information : | Mutant shows highly specific defects in the caudal migration of the nVII motor neurons.The maternal and zygotic mutant shows defects in convergent extension (CE) movements during gastrulation.rw468 allele has a point mutation (stop codon) in the LRR domain of Scrb1. |
Gene : | scribble1 |
Publications : | Wada H et al (2005) Development 132(10),2273-85 |
Taxonomy : | Siluriformes |
Reference : | Sun SD, Purdy AM, Walsh GS. (2016) Planar cell polarity genes Frizzled3a, Vangl2, and Scribble are required for spinal commissural axon guidance. BMC Neurosci 17(1) 83 McArthur KL, Fetcho JR. (2017) Key Features of Structural and Functional Organization of Zebrafish Facial Motor Neurons Are Resilient to Disruption of Neuronal Migration. Curr Biol 27(12) 1746-1756.e5 |
Zebrafish: | ko157 more | Available | RIKEN CBS |
Category: Mutant
Zebrafish: | ko095 more | Available | RIKEN CBS |
Category: Mutant
Allele : | ko095 |
Publications : | Fukui H et al (2009) Circ. Res. 104(11),1253-9 |
Taxonomy : | Siluriformes |
Reference : | Fukui H, Hanaoka R, Kawahara A. (2009) Noncanonical activity of seryl-tRNA synthetase is involved in vascular development. Circ Res 104(11) 1253-9 |
Zebrafish: | cacnb1 more | Available | RIKEN CBS |
Category: Mutant
Allele : | mi90 |
Information : | The cacnb1 mutants are called relaxed mutants.The mutant phenotype results from a non-sense mutation in the zebrafish cacnb1 gene that encodes the voltage-gated calcium channel beta1 subunit. The zebrafish cacnb1 gene is expressed in skeletal muscles, PNS and CNS. The mutants are immotile due to a defect in excitation-contraction coupling of skeletal muscle. |
Gene : | cacnb1(Cacnb1) |
Publications : | Zhou W et al (2006) Cell Calcium 39(3),227-36 |
Taxonomy : | Siluriformes |
Reference : | Linsley JW, Hsu IU, Wang W, Kuwada JY. (2017) Transport of the alpha subunit of the voltage gated L-type calcium channel through the sarcoplasmic reticulum occurs prior to localization to triads and requires the beta subunit but not Stac3 in skeletal muscles. Traffic 18(9) 622-632 |
Zebrafish: | evanescence more | Available | RIKEN CBS |
Category: Mutant
Allele : | rk10 |
Information : | Loss or strong reduction of granule cells; reduction of Purkinje cells; eye degeneration. |
Publications : | Bae YK et al (2009) Dev. Biol. 330(2),406-26 |
Taxonomy : | Siluriformes |
Reference : | Song KH, Woo SR, Chung JY, Lee HJ, Oh SJ, Hong SO, Shim J, Kim YN, Rho SB, Hong SM, Cho H, Hibi M, Bae DJ, Kim SY, Kim MG, Kim TW, Bae YK. (2017) REP1 inhibits FOXO3-mediated apoptosis to promote cancer cell survival. Cell Death Dis 8(1) e2536 |
Zebrafish: | cfdp1 more | Available | RIKEN CBS |
Category: Mutant
Allele : | ex2+130 |
Information : | A insertion-deletion mutation (+132 bp, -2bp) was introduced in the exon2 of cfdp1 gene by a CRISPR method. The mutation can be detected by PCR with the primers: cfdp1-ex2+130-f, GATAACTTGAGTGAGGATGACAcfdp1-ex2+130-r, CTCATATGGACATCTGCTTTACMutation:WT GAAGGGGAGGATCA------------------------------------------------------------------------------------------------------------------------------------CGACCGGCAGACGCCGMUT GAAGGGGAGGATCAGAAGGAAAAAATACTCATTTTTAACTATGGAAAATATTAGAAAGATTTTAACTAACAGTATATAGAGAAATGAAGGTCAATGGAGTTGGAAATCTGCTACTTCATATTGTACTGCTCCCAAGAGTTGTAAAT--ACCGGCAGACGCCG+132 bp, -2bp |
Gene : | cfdp1 |
Taxonomy : | Siluriformes |
Reference : | Itoh T, Inoue S, Sun X, Kusuda R, Hibi M, Shimizu T. (2021) Cfdp1 controls the cell cycle and neural differentiation in the zebrafish cerebellum and retina. Dev Dyn 250(11) 1618-1633 |