Bio Reaource World Home National BioResource Project Home
Japanese | English
Organism Category
Keyword
You can use "*" for a wildcard search.
Home > Reference Detail
Tabs(ALL, DNA, BLAST, GO, Taxonomy, DO, Reference) are clickable.
DNA
BLAST
Gene Ontology
Taxonomy
Disease Ontology
Reference
Reference Related Resource Count : 31,512

Reference Detail

Reference Information
Author Itoh T, Inoue S, Sun X, Kusuda R, Hibi M, Shimizu T.
Reference Cfdp1 controls the cell cycle and neural differentiation in the zebrafish cerebellum and retina.
Journal Dev Dyn
Volume 250(11)
Page 1618-1633
Year Published 2021
Pubmed ID 33987914

Related Resource Count

3 items
Strain   3 items Go to list of Strain
DNA   0 items
Organism strain
Zebrafish Mutant 1 Go to list
Transgenics 2 Go to list
Organism DNA
Associated Resource is not found.
Strain List 3 items 1 - 3 / 3
Zebrafish: cfdp1  Available RIKEN CBS
Category: Mutant
Allele : ex2+130
Information : A insertion-deletion mutation (+132 bp, -2bp) was introduced in the exon2 of cfdp1 gene by a CRISPR method. The mutation can be detected by PCR with the primers: cfdp1-ex2+130-f, GATAACTTGAGTGAGGATGACAcfdp1-ex2+130-r, CTCATATGGACATCTGCTTTACMutation:WT GAAGGGGAGGATCA------------------------------------------------------------------------------------------------------------------------------------CGACCGGCAGACGCCGMUT GAAGGGGAGGATCAGAAGGAAAAAATACTCATTTTTAACTATGGAAAATATTAGAAAGATTTTAACTAACAGTATATAGAGAAATGAAGGTCAATGGAGTTGGAAATCTGCTACTTCATATTGTACTGCTCCCAAGAGTTGTAAAT--ACCGGCAGACGCCG+132 bp, -2bp
Gene : cfdp1
Taxonomy : Siluriformes
Reference : Itoh T, Inoue S, Sun X, Kusuda R, Hibi M, Shimizu T. (2021) Cfdp1 controls the cell cycle and neural differentiation in the zebrafish cerebellum and retina. Dev Dyn 250(11) 1618-1633
Zebrafish: Tg(atoh1a:GFP)  Available RIKEN CBS
Category: Transgenics
Zebrafish: SAGFF(LF)73A  Available National Institute of GENETICS
Category: Transgenics
Information : GFP expression in whole organism at day 1.GFP expression in whole organism at day 5.
Taxonomy : Siluriformes
Reference : Iida A, Wang Z, Hondo E, Sehara-Fujisawa A. (2020) Generation and evaluation of a transgenic zebrafish for tissue-specific expression of a dominant-negative Rho-associated protein kinase-2. Biochem Biophys Res Commun
Itoh T, Inoue S, Sun X, Kusuda R, Hibi M, Shimizu T. (2021) Cfdp1 controls the cell cycle and neural differentiation in the zebrafish cerebellum and retina. Dev Dyn 250(11) 1618-1633
Kazuhide Asakawa, Hiroshi Handa, Koichi Kawakami (2022) Optogenetic Phase Transition of TDP-43 in Spinal Motor Neurons of Zebrafish Larvae Journal of Visualized Experiments
Iida A, Wang Z, Hirata H, Sehara-Fujisawa A. (2018) Integrin β1 activity is required for cardiovascular formation in zebrafish. Genes Cells 23(11) 938-951
Muto A, Ohkura M, Kotani T, Higashijima S, Nakai J, Kawakami K. (2011) Genetic visualization with an improved GCaMP calcium indicator reveals spatiotemporal activation of the spinal motor neurons in zebrafish. Proc Natl Acad Sci U S A 108(13) 5425-30
Asakawa K, Suster ML, Mizusawa K, Nagayoshi S, Kotani T, Urasaki A, Kishimoto Y, Hibi M, Kawakami K. (2008) Genetic dissection of neural circuits by Tol2 transposon-mediated Gal4 gene and enhancer trapping in zebrafish. Proc Natl Acad Sci U S A 105(4) 1255-60
Asakawa K, Kawakami K. (2010) A transgenic zebrafish for monitoring in vivo microtubule structures. Dev Dyn 239(10) 2695-9
Iwasaki M, Kuroda J, Kawakami K, Wada H. (2018) Epidermal regulation of bone morphogenesis through the development and regeneration of osteoblasts in the zebrafish scale. Dev Biol 437(2) 105-119
Asakawa K, Kawakami K. (2018) Protocadherin-Mediated Cell Repulsion Controls the Central Topography and Efferent Projections of the Abducens Nucleus. Cell Rep 24(6) 1562-1572
Sternberg JR, Severi KE, Fidelin K, Gomez J, Ihara H, Alcheikh Y, Hubbard JM, Kawakami K, Suster M, Wyart C. (2016) Optimization of a Neurotoxin to Investigate the Contribution of Excitatory Interneurons to Speed Modulation In Vivo. Curr Biol 26(17) 2319-28