Bio Reaource World Home National BioResource Project Home
Back to Home
Japanese | English
Organism Category
Keyword
You can use "*" for a wildcard search.
Home
Tabs(ALL, DNA, BLAST, GO, Taxonomy, DO, Reference) are clickable.
DNA
BLAST
Gene Ontology
Taxonomy
Reference
Reference Related Resource Count: 33,482
Organism Zebrafish Category Mutant strain or clone Strain

Associated Resources List
7 items Page:    1 / 1 1 1 - 7 / 7 Show All
Zebrafish: landlocked more  Available RIKEN CBS
Category: Mutant
Allele : rw16
Information : Mutant shows highly specific defects in the caudal migration of the nVII motor neurons. The maternal and zygotic mutant shows defects in convergent extension (CE) movements during gastrulation. rw16 allele has a point mutation (amino acid substitution) in the first PDZ domain of Scrb1.
Gene : scribble1
Publications : Wada H et al (2005) Development 132(10),2273-85
Taxonomy : Siluriformes
Reference : Sun SD, Purdy AM, Walsh GS. (2016) Planar cell polarity genes Frizzled3a, Vangl2, and Scribble are required for spinal commissural axon guidance. BMC Neurosci 17(1) 83
McArthur KL, Fetcho JR. (2017) Key Features of Structural and Functional Organization of Zebrafish Facial Motor Neurons Are Resilient to Disruption of Neuronal Migration. Curr Biol 27(12) 1746-1756.e5
Zebrafish: landlocked more  Available RIKEN CBS
Category: Mutant
Allele : rw468
Information : Mutant shows highly specific defects in the caudal migration of the nVII motor neurons.The maternal and zygotic mutant shows defects in convergent extension (CE) movements during gastrulation.rw468 allele has a point mutation (stop codon) in the LRR domain of Scrb1.
Gene : scribble1
Publications : Wada H et al (2005) Development 132(10),2273-85
Taxonomy : Siluriformes
Reference : Sun SD, Purdy AM, Walsh GS. (2016) Planar cell polarity genes Frizzled3a, Vangl2, and Scribble are required for spinal commissural axon guidance. BMC Neurosci 17(1) 83
McArthur KL, Fetcho JR. (2017) Key Features of Structural and Functional Organization of Zebrafish Facial Motor Neurons Are Resilient to Disruption of Neuronal Migration. Curr Biol 27(12) 1746-1756.e5
Zebrafish: ko157 more  Available RIKEN CBS
Category: Mutant
Allele : ko157
Publications : Kawahara A et al (2009) Science 323(5913),524-7
Taxonomy : Siluriformes
Reference : Kawahara A, Nishi T, Hisano Y, Fukui H, Yamaguchi A, Mochizuki N. (2009) The sphingolipid transporter spns2 functions in migration of zebrafish myocardial precursors. Science 323(5913) 524-7
Hisano Y, Inoue A, Okudaira M, Taimatsu K, Matsumoto H, Kotani H, Ohga R, Aoki J, Kawahara A. (2015) Maternal and Zygotic Sphingosine Kinase 2 Are Indispensable for Cardiac Development in Zebrafish. J Biol Chem 290(24) 14841-51
Zebrafish: ko095 more  Available RIKEN CBS
Category: Mutant
Allele : ko095
Publications : Fukui H et al (2009) Circ. Res. 104(11),1253-9
Taxonomy : Siluriformes
Reference : Fukui H, Hanaoka R, Kawahara A. (2009) Noncanonical activity of seryl-tRNA synthetase is involved in vascular development. Circ Res 104(11) 1253-9
Zebrafish: cacnb1 more  Available RIKEN CBS
Category: Mutant
Allele : mi90
Information : The cacnb1 mutants are called relaxed mutants.The mutant phenotype results from a non-sense mutation in the zebrafish cacnb1 gene that encodes the voltage-gated calcium channel beta1 subunit. The zebrafish cacnb1 gene is expressed in skeletal muscles, PNS and CNS. The mutants are immotile due to a defect in excitation-contraction coupling of skeletal muscle.
Gene : cacnb1(Cacnb1)
Publications : Zhou W et al (2006) Cell Calcium 39(3),227-36
Taxonomy : Siluriformes
Reference : Linsley JW, Hsu IU, Wang W, Kuwada JY. (2017) Transport of the alpha subunit of the voltage gated L-type calcium channel through the sarcoplasmic reticulum occurs prior to localization to triads and requires the beta subunit but not Stac3 in skeletal muscles. Traffic 18(9) 622-632
Zebrafish: evanescence more  Available RIKEN CBS
Category: Mutant
Allele : rk10
Information : Loss or strong reduction of granule cells; reduction of Purkinje cells; eye degeneration.
Publications : Bae YK et al (2009) Dev. Biol. 330(2),406-26
Taxonomy : Siluriformes
Reference : Song KH, Woo SR, Chung JY, Lee HJ, Oh SJ, Hong SO, Shim J, Kim YN, Rho SB, Hong SM, Cho H, Hibi M, Bae DJ, Kim SY, Kim MG, Kim TW, Bae YK. (2017) REP1 inhibits FOXO3-mediated apoptosis to promote cancer cell survival. Cell Death Dis 8(1) e2536
Zebrafish: cfdp1 more  Available RIKEN CBS
Category: Mutant
Allele : ex2+130
Information : A insertion-deletion mutation (+132 bp, -2bp) was introduced in the exon2 of cfdp1 gene by a CRISPR method. The mutation can be detected by PCR with the primers: cfdp1-ex2+130-f, GATAACTTGAGTGAGGATGACAcfdp1-ex2+130-r, CTCATATGGACATCTGCTTTACMutation:WT GAAGGGGAGGATCA------------------------------------------------------------------------------------------------------------------------------------CGACCGGCAGACGCCGMUT GAAGGGGAGGATCAGAAGGAAAAAATACTCATTTTTAACTATGGAAAATATTAGAAAGATTTTAACTAACAGTATATAGAGAAATGAAGGTCAATGGAGTTGGAAATCTGCTACTTCATATTGTACTGCTCCCAAGAGTTGTAAAT--ACCGGCAGACGCCG+132 bp, -2bp
Gene : cfdp1
Taxonomy : Siluriformes
Reference : Itoh T, Inoue S, Sun X, Kusuda R, Hibi M, Shimizu T. (2021) Cfdp1 controls the cell cycle and neural differentiation in the zebrafish cerebellum and retina. Dev Dyn 250(11) 1618-1633
 
Page Top