Home   >   Zebrafish Mutant List

>   Resource Information

Tabs(ALL, DNA, BLAST, GO, Taxonomy, DO, Reference) are clickable.

Resource count: 6,594,866

Resource Information cfdp1

Resource Information
Organism	Zebrafish
strain or clone	Strain
Category	Mutant
Resource name	cfdp1
Availability	Available
Features	Allele : ex2+130 Information : A insertion-deletion mutation (+132 bp, -2bp) was introduced in the exon2 of cfdp1 gene by a CRISPR method. The mutation can be detected by PCR with the primers: cfdp1-ex2+130-f, GATAACTTGAGTGAGGATGACAcfdp1-ex2+130-r, CTCATATGGACATCTGCTTTACMutation:WT GAAGGGGAGGATCA------------------------------------------------------------------------------------------------------------------------------------CGACCGGCAGACGCCGMUT GAAGGGGAGGATCAGAAGGAAAAAATACTCATTTTTAACTATGGAAAATATTAGAAAGATTTTAACTAACAGTATATAGAGAAATGAAGGTCAATGGAGTTGGAAATCTGCTACTTCATATTGTACTGCTCCCAAGAGTTGTAAAT--ACCGGCAGACGCCG+132 bp, -2bp Gene : cfdp1 Taxonomy : Siluriformes Reference : Itoh T, Inoue S, Sun X, Kusuda R, Hibi M, Shimizu T. (2021) Cfdp1 controls the cell cycle and neural differentiation in the zebrafish cerebellum and retina. Dev Dyn 250(11) 1618-1633
Resouce detail information (request form)	http://shigen.nig.ac.jp/zebrafish/strainDetailAction.do?strainId=62056

---

Distributors information
Organization	Developmental Gene Regulation. RIKEN Brain Science Institute
Person in charge	OKAMOTO Hitoshi
Postal Code
Address
Phone
FAX
E-mail	hitoshi.okamoto@riken.jp
URL
Other information

Page Top